Specimen Information

Sample Storage
Sample ID: ZFMK-TIS-2528531
Catalog Number: ZFMK-TIS-2528531
Voucher Type:
Voucher Description:
Institution Storing: Zoologisches Forschungsmuseum Alexander Koenig, Bonn
Identification Provided by: Christoph Muster
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Araneae
Family: Araneidae
Genus: Argiope
Species: Argiope bruennichi
Sample Collection
Ocean:
Country: Germany
State: Lower Saxony
Region: Lower Saxony
Exact Site: Suederleda/Ahlenmoor
Latitude: 53.71
Longitude: 8.8
Coordinate: GPS
Collectors: GBOL-Team ZFMK
Collectiondate:
Specimen Details
Sex:
Life Stage: juvenile
Reproduction:
Notes: http://id.zfmk.de/collection_ZFMK/2528531/865698/138798
   
   
   
   
   
   

Sequence Details

Sequence ID: GBBSP1740-15
Marker Code: COI-5P
Residues: 658
AACTTTATACTTGATTTTTGGAGCTTGAGCTGCTATAGTGGGTACAGCAATAAGAGTATTGATTCGAATTGAATTAGGACAGCCTGGGAGATTTATGGGTGATGATCAATTATATAATGTAATTGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATCTTGATTGGGGGTTTTGGGAACTGGTTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATGAATAATTTAAGGTTTTGGTTATTACCTCCTTCATTATTTCTTTTAATTGTTTCTTCAATAGTAGAAATAGGAGTAGGAGCAGGATGAACAGTGTATCCCCCATTGGCTGGATTAGAAGGTCATGCTGGGAGATCCGTAGATTTTGCAATTTTTTCACTTCATTTGGCTGGGGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCAACAATTATTAATATGCGATTTTATGGAATAACAATAGAAAAGGTACCTTTATTTGTTTGGTCTGTTTTAATTACGGCTGTTCTTTTATTATTATCTTTACCTGTTTTAGCAGGGGCTATTACAATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTTCAGGGGGTGGGGATCCTATTTTATTTCAGCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available.

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.