Specimen Information

Sample Storage
Sample ID: ZFMK-TIS-20944
Catalog Number: ZFMK-TIS-20944
Voucher Type:
Voucher Description:
Institution Storing: Zoologisches Forschungsmuseum Alexander Koenig, Bonn
Identification Provided by: Bernhard A. Huber
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Araneae
Family: Araneidae
Genus: Argiope
Species: Argiope bruennichi
Sample Collection
Ocean:
Country: Austria
State:
Region: Ramsau
Exact Site: near Ramsau
Latitude: 47.85
Longitude: 14.24
Coordinate:
Collectors: GBOL-Team ZFMK
Collectiondate:
Specimen Details
Sex: M
Life Stage: adult
Reproduction:
Notes: http://id.zfmk.de/collection_ZFMK/20944/475352/44762
   
   
   
   
   
   

Sequence Details

Sequence ID: GBBSP1059-15
Marker Code: COI-5P
Residues: 658
AACTTTATACTTGATTTTTGGAGCTTGAGCTGCTATAGTGGGTACAGCAATAAGAGTATTGATTCGAATTGAATTAGGACAGCCTGGGAGATTTATGGGTGATGATCAATTATATAATGTAATTGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATCTTGATTGGGGGTTTTGGGAACTGGTTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATGAATAATTTAAGGTTTTGGTTATTACCTCCTTCATTATTTCTTTTAATTGTTTCTTCAATAGTAGAAATAGGAGTAGGAGCAGGATGAACAGTGTATCCCCCATTGGCTGGATTAGAAGGTCATGCTGGGAGATCCGTAGATTTTGCAATTTTTTCACTTCATTTGGCTGGGGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCAACAATTATTAATATGCGATTTTATGGAATAACAATAGAAAAGGTACCTTTATTTGTTTGGTCTGTTTTAATTACGGCTGTTCTTTTATTATTATCTTTACCTGTTTTAGCAGGGGCTATTACAATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTTCAGGGGGTGGGGATCCTATTTTATTTCAGCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available.

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.