Specimen Information

Sample Storage
Sample ID: BIOUG21866-F03
Catalog Number: BIOUG21866-F03
Voucher Type: E-Vouchered(DNA/Tissue+Photo)
Voucher Description:
Institution Storing: University of Guelph, Centre for Biodiversity Genomics
Identification Provided by: Angela Telfer
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Sarcoptiformes
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region:
Exact Site:
Latitude: 43.537
Longitude: -80.134
Coordinate:
Collectors: Paul Hebert
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: FMON063-15
Marker Code: COI-5P
Residues: 658
TACTTTGTATTTTATTTTTGGTGTTTGATCTGGGATGTTTGGGACTAGGTTAAGAAGTTTGATTCGTTTTGAGCTATCTCAACCTGGGGATTTTATGATAGATTTTGATTATTATAATTCTGTTGTTACCGCCCATGCTTTTATTATGATTTTTTTTATAGTGATGCCTATTATGATAGGGGGTTTTGGTAATTTGTTAATTCCTGTGATAATCGGAGCCACGGATATGGCGTACCCTCGGTTAAATAATATAAGTTTTTGGCTTTTACCTCCTTCTTTGTCTTTACTTATTAGATCTGCGGTGGTAGGGTCGGGGGTTGGTACAGGTTGAACTGTTTACCCTCCTTTGTCTAATGGAATTTTTCATTCTGGGCCTGCTGTTGATTTTGGTATTTTAAGATTACACATTGCGGGGGTTTCTTCTATTCTTGGTTCTATTAATTTTATTGTTACTATTTTTAATATGAAAGTGGAAGGCATATTATGATCTAATGTTCCTCTTTTTGTTTGATCAGTGTTAATTACTTCTTTTTTGTTAGCTTTTTCTTTACCTGTTTTAGCTGCGGCTTTAACTATATTATTAACTGATCGTAATTTTAATTCGACTTTTTTTGATCCTGTTGGGGGAGGAGATCCTATTTTATATCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.