Specimen Information

Sample Storage
Sample ID: BC ZSM ARA 00525
Catalog Number: BC ZSM ARA 00525
Voucher Type:
Voucher Description:
Institution Storing: SNSB, Zoologische Staatssammlung Muenchen
Identification Provided by: Karl-Hinrich Kielhorn
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Araneae
Family: Araneidae
Genus: Argiope
Species: Argiope bruennichi
Sample Collection
Ocean:
Country: Germany
State: Berlin
Region: Schmoeckwitz
Exact Site: Forst Koepenick, Abt. 29, Langes Luch
Latitude: 52.3739
Longitude: 13.6661
Coordinate:
Collectors: K.H. Kielhorn
Collectiondate:
Specimen Details
Sex: M
Life Stage: adult
Reproduction: S
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: FBARB525-11
Marker Code: COI-5P
Residues: 658
AACTTTATACTTGATTTTTGGAGCTTGAGCTGCTATAGTGGGTACAGCAATAAGAGTATTGATTCGAATTGAATTAGGACAGCCTGGGAGATTTATGGGTGATGATCAATTATATAATGTAATTGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATCTTGATTGGGGGTTTTGGGAACTGGTTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATGAATAATTTAAGGTTTTGGTTATTACCTCCTTCATTATTTCTTTTAATTGTTTCTTCAATAGTAGAAATAGGAGTAGGAGCAGGATGAACAGTGTATCCCCCATTGGCTGGATTAGAAGGTCATGCTGGGAGATCCGTAGATTTTGCAATTTTTTCACTTCATTTGGCTGGGGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCAACAATTATTAATATGCGATTTTATGGAATAACAATAGAAAAGGTACCTTTATTTGTTTGGTCTGTTTTAATTACGGCTGTTCTTTTATTATTATCTTTACCTGTTTTAGCAGGGGCCATTACAATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTTCAGGGGGTGGGGATCCTATTTTATTTCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.