Specimen Information

Sample Storage
Sample ID: 0-0801-01
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing: Biodiversity Institute of Ontario
Identification Provided by: Namkang Sriwattanarothai
Taxonomy
Phylum: Chordata
Class: Actinopterygii
Order: Anabantiformes
Family: Osphronemidae
Genus: Trichopsis
Species: Trichopsis vittata
Sample Collection
Ocean:
Country: Thailand
State: Lampang
Region:
Exact Site:
Latitude: 18.4
Longitude: 99.5
Coordinate:
Collectors: Local collector
Collectiondate: 2008-07-21
Specimen Details
Sex: F
Life Stage: A
Reproduction: S
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: DSANA056-08
Marker Code: COI-5P
Residues: 652
CCTTTATCTAGTTTTCGGTGCTTGAGCCGGAATAGTGGGTACTGCTTTAAGCCTACTAATCCGTGCAGAACTAAGTCAGCCCGGAGCTCTTCTTGGAGACGACCAAATTTATAATGTAATCGTAACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAGTTATAATTGGAGGTTTTGGAAACTGATTAGTCCCACTTATAATTGGTGCACCAGACATGGCATTCCCTCGAATAAACAATATAAGTTTTTGACTCCTGCCCCCTTCTTTCCTGCTACTACTAGCATCCTCCGGTGTTGAAGCAGGAGCCGGAACAGGTTGAACCGTGTACCCTCCTTTAGCCAGCAACCTAGCTCATGCAGGTGCCTCCGTTGATTTAACAATTTTTTCTCTACATCTAGCAGGTGTCTCTTCAATTTTAGGAGCTATCAATTTTATTACCACTATTATTAACATAAAACCCCCTGCCATCTCTCAATATCAGACGCCTCTTTTCGTATGAGCAGTATTAATTACAGCCGTACTACTTTTATTATCACTTCCAGTATTAGCTGCTGGAATTACAATACTGCTAACAGATCGCAATCTAAATACCACTTTCTTTGACCCAGCCGGAGGGGGGGATCCAATTTTATATCAACACCTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available.

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.