Specimen Information

Sample Storage
Sample ID: ANIC Gen No. 004300
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing: Australian National Insect Collection
Identification Provided by: Edward D. Edwards
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family: Crambidae
Genus: Hednota
Species: Hednota bivittella
Sample Collection
Ocean:
Country: Australia
State: Victoria
Region:
Exact Site: 17 miles NNE of Benambra
Latitude: -36.955
Longitude: 147.703
Coordinate:
Collectors: I.F.B.Common
Collectiondate:
Specimen Details
Sex:
Life Stage: A
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AANIC179-10
Marker Code: COI-5P
Residues: 307
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTGAGACTTTTAATTCGAGCTGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTACTTCCCCCCTCTTTAACTTTATTAATTTCTAGAAGAATTGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||

Photograph

No image available.

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.