Specimen Information

Sample Storage
Sample ID: TM 24270
Catalog Number: TM 24270
Voucher Type:
Voucher Description:
Institution Storing: Ditsong National Museum of Natural History
Identification Provided by: Charles Haddad
Taxonomy
Phylum: Arthropoda
Class: Arachnida
Order: Araneae
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: South Africa
State: KwaZulu-Natal
Region:
Exact Site:
Latitude: -28.413
Longitude: 32.418
Coordinate:
Collectors: R. Lyle
Collectiondate:
Specimen Details
Sex: F
Life Stage: Subadult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AAI123-13
Marker Code: COI-5P
Residues: 658
GACTTTATATTTAATATTTGGAGCTTGATCGGCTATAGTAGGAACGGCAATAAGAGTATTGATTCGAATAGAATTAGGTCAGGTTGGTAGATTTTTAGGGAGTGATCAGTTATATAATGTAATTGTAACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTTTGATTGGTGGATTTGGGAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCTCCTTCATTAATATTATTATTTTTATCTTCTATAGCTGACATAGGTGTAGGTGCAGGATGAACAATTTATCCTCCTTTGGCTGGATTATTGGGACATGGAGGGAATGCAGTTGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTACTACAATTATTAATATACGGTCTTATAGAATATCTATAGATAAGATCCCATTATTTGTATGATCTGTATTAATTACAGCAATTTTATTGTTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGACCCGGCAGGAGGAGGTGATCCTATTTTATTTCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.