Specimen Information

Sample Storage
Sample ID: AAD-79532
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing: Australian Antarctic Division
Identification Provided by:
Taxonomy
Phylum: Annelida
Class: Polychaeta
Order: Terebellida
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Antarctica
State:
Region:
Exact Site:
Latitude: -68.52
Longitude: 78.066
Coordinate:
Collectors: AAD Dive Team
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: AADBE007-10
Marker Code: COI-5P
Residues: 657
AACCTTATACTTTCTATTTGGTGTATGAGGTGGCCTCCTCGGGACATCTATAAGACTCTTAATTCGTATTGAATTAGGACAACCTGGATCATTCCTCGGGAGAGACCAACTCTATAACACCGTTGTCACGGCCCATGCATTTTTAATAATTTTCTTTCTAGTAATACCTATTCTCATTGGGGGGTTTGGTAACTGGCTTCTCCCCCTTATACTCGGGGCCCCAGATATGGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTCTTCCCCCTGCCCTAATACTCCTCCTGAGATCCGCCGCCGTGGAAAAAGGAGCTGGGACAGGATGAACAGTCTACCCCCCTTTAGCAAGGAACTTAGCCCATGCAGGGCCCTCAGTAGACCTTGCCATTTTTTCACTCCATTTAGCTGGAATCTCCTCCATCTTAGGAGCTATTAATTTTATCACAACCGTTGCCAATATACGATGAAAAGGACTACGATTAGAACGTATCCCTCTATTCGTATGAGCAGTAAATATTACAGTTGTCCTTTTACTATTATCCCTCCCAGTCCTAGCCGGGGCAATCACAATACTTTTAACAGACCGAAATGTAAATACTTCTTTCTTTGACCCAGCAGGTGGGGGAGACCCCATCCTTTATCAACATTTATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available.

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.